genoma.unsam.edu.ar :: tca :: tca-09d14.b1

Sequence

>tca-09d14.b1
CCACGCGTCCGCATGAGGCGAAGTACTTCGCGGTGCTCTATTATGGAACTACATTTGCGC
ACAATCGCCTCTACTAATTTCGAAACCAAGTTTTGTTATGTCGACGTTGAAAGAATCCCT
GCCTTGGCAGAAAGGTTCAATGTAATGATGTTACCAACTCTGATGCTGATTGAAAATAAA
AATACCTTCCACAGTATCATTGGATTTGATGAATTTGGAGGAACCGATGATTTTGCGACG
TCCACTGTGATAAATGTTTTATCCCATTATGGAATGATAAATGCTCGTGGAATGTTTTCT
GCCGATCAAAGCAATGACTAGAATTCTTATAATTTTTATGTGTTCTCTT


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|O18883|14P_BOVIN PROTEIN 1-4   Goto Swissprot  
Score: 72.4  Expect: 1e-12
nr  BLAST report  
emb|CAB55372.1| (AL117260) potential member of the thioredoxin family [Leishmania major]   Goto GenBank  
Score: 164  Expect: 1e-39
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.7875  indefinite