genoma.unsam.edu.ar :: tca :: tca-09e22.b1.GL

Sequence

>tca-09e22.b1.GL
GAAAGCTTTAGGATCACAGGAGGCATATGACTTTTTGGATCTATGCTTTCGTCGCAATGT
TGCCGAAAGACCTGATGCTACTGCGCTTTTGAAGCATCCATTTCTTCAATTGTAGTAGAG
TGAAGGAAATACATCCATTGAAAGGAGTAAAAAGGAACAAAAAGGAACGAAAATAAAACA
GTAATTTGAAGAATGAAAAAAGAAAGCGAGAATGAGAGAAATAGAGAAAGAGAGAAGCAC
A


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
No hits  
nr  BLAST report  
gb|AAC97114.1| (AF093689) MEK kinase alpha [Dictyostelium discoideum]   Goto GenBank  
Score: 52.4  Expect: 8e-06
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.6667  noncoding