genoma.unsam.edu.ar :: tca :: tca-09f20.b1

Sequence

>tca-09f20.b1
CCACGCGTCCGCGAAATGCACCACGAGCAGCTCGCCGAGGCCTGCCCCGGTGACAACGTC
GGTTTCAACGTAAAGAACGTGTCTGTGAAGGACATCCGCCGTGGAAACGTGTGCGGTAAC
TCGAAGCAGGACCCGCCGAAGGAGGCCGCCGACTTCACTGCGCAGGTGATCATCCTCAAC
CACCCCGGCCAGATCGGCAACGGCTACGCCCCCGTCCTCGACTGCCACACCTGCCACATC
GCGTGCAAGTTCGCCGAAATCGAGTCCAAGATTGACCGCCGCTCGGGCAAGGAGCTGGAG
AAGAACCCCAAGGCGATCAAGTCCGGCGACGCCGCGATCGTGCGCATGGTGCCCAGCAAG
CCCATGTGCGTGGAGGTCTTCAACGACTACGCACC


BLAST summary (best hit)

trypHTG  BLAST report  
emb|AL499619.1|LMFLCHR16 Leishmania major chromosome 16,17 clone Chr.16,Chr.17 strain Friedlin, *** SEQUENCING IN PROGRESS ***, in unordered pieces   Goto GenBank  
Score: 484  Expect: 1e-136
sp  BLAST report  
sp|P41166|EF1A_TRYBB ELONGATION FACTOR 1-ALPHA (EF-1-ALPHA)   Goto Swissprot  
Score: 317  Expect: 3e-86
nr  BLAST report  
pir||JC5117 translation elongation factor eEF-1 alpha - Trypanosoma cruzi gb|AAC01751.1| (L76077) elongation factor 1-alpha [Trypanosoma cruzi]   Goto GenBank  
Score: 318  Expect: 6e-86
trypEST  BLAST report  
gb|AI622920.1|AI622920 TENG0420 T. Cruzi epimastigote normalised cDNA Library Trypanosoma cruzi cDNA clone n768.r 5', mRNA sequence   Goto GenBank  
Score: 525  Expect: 1e-149

Testcode evaluation

Score  Evaluation  
1.3368  coding