genoma.unsam.edu.ar :: tca :: tca-09f23.b1

Sequence

>tca-09f23.b1
CCACGCGTCCGATCTGAATCTTGAGCAAAAGATTCCACCGACTGACCCTCATTCAAGTAA
GCTATTGGCCGATCAAATAATCGCGTATGAATTGCAAAAATACGACCCCGCAATTAATTC
TATACGACATGGTTTTGATGAAGTTGTTCCATTATATACATTGAGTGCCTTTCGATGGCA
ACAAGTTGAACTAGTTATCTGCGGAACACCAAAACTTTCTTTTGAGGCTTTGCGAGATGC
ATGTGAAATACACTTACCTTCAGCTGGGCTCGATATGTTTTTAGATGTTCTTAAGAATAT
GACAGATGAGGATCGCATGCTTCTCTTACGATTTACAACCGGTCAAACAAGACTTCCGTT
AAAGGAAGCCATCAAAGTTCAACATAATGGTACTCTAGATTCACTCCCTACAAGCAGCAC
ATGCTTCTTTACCCTTCGTTTGCCTACATATTCATCGACAGAAGCTATGCGAGAGAAAAT
ACTTTACGCTATACGTCAATGC


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|Q05086|UE3A_HUMAN UBIQUITIN-PROTEIN LIGASE E3A (ONCOGENIC PROTEIN-ASSOCIATED PROTEIN E6-AP) (HUMAN PAPILLOMAVIRUS E6-ASSOCIATED PROTEIN)   Goto Swissprot  
Score: 82.4  Expect: 1e-15
nr  BLAST report  
gb|AAG01362.1|AC068666_9 (AC068666) L1905.9 [Leishmania major]   Goto GenBank  
Score: 223  Expect: 3e-57
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.8921  indefinite