genoma.unsam.edu.ar :: tca :: tca-09f4.b1

Sequence

>tca-09f4.b1
CCACGCGTCCGACTATATTGGGCGTTAAGCCAAAATAGGGAGTTGTTATGTAAGTCTGCC
ATGGCATCGACTCAGGGGAACTCCAGTGCATCTGCACGCCTGCAGAAAGAGTTTATGGAG
CTTATGATGGGAGGCCCGGTTGGAATCTCTGCCTTCCCGCAGAACGATAATCTCTTTCAC
TGGATTGGCACTGTGCAAGGGGTGGCCAACACCATCTATGAGGACCTCGAATTTCAACTT
TCTCTA


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P56616|UBCB_XENLA UBIQUITIN-CONJUGATING ENZYME X (UBIQUITIN-PROTEIN LIGASE) (UBIQUITIN CARRIER PROTEIN)   Goto Swissprot  
Score: 105  Expect: 2e-22
nr  BLAST report  
pdb|1I7K|A Chain A, Crystal Structure Of Human Mitotic-Specific Ubiquitin- Conjugating Enzyme, Ubch10 pdb|1I7K|B Chain B, Crystal Structure Of Human Mitotic-Specific Ubiquitin- Conjugating Enzyme, Ubch10   Goto GenBank  
Score: 105  Expect: 1e-21
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.7986  indefinite