genoma.unsam.edu.ar :: tca :: tca-09l24.b1

Sequence

>tca-09l24.b1
TCTCTCGAACCCTGTGGGCTCCACTTTCTGCGGCACGCCGTATTACCTCAGCCCTGAGCT
TTGGCGCCGCGCGCCGTACAGCAAGAAGAGCGAAATGTGGGCGCTGGGCGTTGTGCTGTA
CGAAGTGATAGCCCTCAAG


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|Q08942|NRKA_TRYBB PUTATIVE SERINE/THREONINE-PROTEIN KINASE A   Goto Swissprot  
Score: 135  Expect: 2e-34
nr  BLAST report  
sp|Q08942|NRKA_TRYBB PUTATIVE SERINE/THREONINE-PROTEIN KINASE A pir||T11854 protein kinase (EC 2.7.1.-) - Trypanosoma brucei gb|AAB59252.1| (L03778) protein kinase [Trypanosoma brucei]   Goto GenBank  
Score: 135  Expect: 1e-33
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.0511  coding