genoma.unsam.edu.ar :: tca :: tca-09n15.b1

Sequence

>tca-09n15.b1
GCACCCAGGCGGCGAAGCAGACGAAGGCCGGCGTGCTGATCCCCGAGCAGGTTGCGGGGA
AGGTCAACGAGGGGACTGTGGTCGCCGTCGCGGCGGCGTCGAAGGACTGGACGCCTACA


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|Q04984|CH10_HUMAN 10 KDA HEAT SHOCK PROTEIN, MITOCHONDRIAL (HSP10) (10 KDA CHAPERONIN) (CPN10)   Goto Swissprot  
Score: 72.4  Expect: 1e-12
nr  BLAST report  
gb|AAK77863.1|AF394959_1 (AF394959) co-chaperonin CPN10 [Leishmania donovani]   Goto GenBank  
Score: 158  Expect: 6e-38
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.277  coding