genoma.unsam.edu.ar :: tca :: tca-09n21.b1

Sequence

>tca-09n21.b1
GCGAGCTAACATTGCGGGCCTAACAAAGACGTCCGTGCCGTTTCTTGTGAATGCTCTAGA
TGAAGTGGTACGAACTGTGAAGAGTAATTAAGAAGAAGCGAGCGGAAGCCATTTTTAATT
GCATATAAAAAGGACTCATGAGCTGTTCCTGTTTGCATTTCCGTGACCGGAAAGGGGATA
ATAATTTTGCGTGTATGTGTATGTACACATACAAGGGAAAAGGGAATGGATGGGAATAAT
TGAGAGTGCGAAAGCATATGGAAAGCGTTAGCGGA


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|Q22067|AATC_CAEEL PROBABLE ASPARTATE AMINOTRANSFERASE, CYTOPLASMIC (TRANSAMINASE A) (GLUTAMATE OXALOACETATE TRANSAMINASE-1)   Goto Swissprot  
Score: 73.9  Expect: 5e-13
nr  BLAST report  
gb|AAK73815.1|AF326989_1 (AF326989) aspartate aminotransferase [Trypanosoma brucei]   Goto GenBank  
Score: 85.5  Expect: 1e-15
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.7743  indefinite