genoma.unsam.edu.ar :: tca :: tca-09o18.b1

Sequence

>tca-09o18.b1
AACTGACGTATGATGAAGTTCTCAATGGATGTCGCGATGTATTGAAGCTGGAAGAATTTA
CAACCCGTCTGCGCGACATCACCAAGCGTGCGTTCAACAAAGCAAATGATATGGGGACCA
AGGTGGAGGGCAAGGGCTCTGAGGATATTGTGGAGTTCCTCGAGTTCCGCTCGATGCTTT
GCTACGTCTACGATTACTTTGAACTGACTGTTATGTTCGACGAGATCGACACCTCGGGCT
ATATGCTGATTGACGCGAAGGAATTCAAGGAAGCTGCCCCCAAGATTGAGTCATGGGGTG
TGAAGATGGAGGATCCTGAAAAGATCTTCAAGGAGCTTGACAAAAAC


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|Q27052|FCA1_TRYRA FLAGELLAR CALCIUM-BINDING PROTEIN   Goto Swissprot  
Score: 255  Expect: 8e-68
nr  BLAST report  
pir||S14665 probable calcium-binding protein TL17 - Trypanosoma lewisi (fragment)   Goto GenBank  
Score: 259  Expect: 4e-68
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.2061  coding