genoma.unsam.edu.ar :: tca :: tca-10f15.b1.GL

Sequence

>tca-10f15.b1.GL
CCACGCGTCCGCTTGTTCGACAACATTGACTTCCAGGCCACTATCACCCGCGCACGCTTC
GAGGAGCTGTGCGGCGACCTCTTCCGCGGCACAGTGCAGCCGGTGGAGCGCGTGCTGC


BLAST summary (best hit)

trypHTG  BLAST report  
emb|AL499624.2|LMFLCHR36 Leishmania major chromosome 36 clone Chr.36 strain Friedlin, *** SEQUENCING IN PROGRESS ***, in ordered pieces   Goto GenBank  
Score: 278  Expect: 4e-74
sp  BLAST report  
sp|P08108|HS70_ONCMY HEAT SHOCK COGNATE 70 KD PROTEIN (HSP70)   Goto Swissprot  
Score: 84.7  Expect: 3e-41
nr  BLAST report  
ref|NP_112442.1| heat shock protein cognate 70 [Mus musculus] pir||A45935 dnaK-type molecular chaperone hsc70 - mouse gb|AAA37869.1| (M19141) heat shock protein 70 cognate [Mus musculus] gb|AAB18391.1| (U73744) heat shock 70 protein [Mus musculus]   Goto GenBank  
Score: 84.0  Expect: 1e-43
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
1.1207  coding