genoma.unsam.edu.ar :: tca :: tca-10f15.b1

Sequence

>tca-10f15.b1
GACTTCCAGGCCACTATCACCCGCGCACGCTTCGAGGAGCTGTGCGGCGACCTCTTCCGC
GGCACAGTGCAGCCGGTGGAGCGCGTGCTGCATGACGCGAAGATGGACAAGCGCGCGGTG
CACGACGTGGTGCTGGTGGGCGGCTCCACGCGCATCCCAAAGGTGATGCAGCTGGTGTCG
GACTTCTTCGGCGGCAAGGAACTGAACAAGAGCATCAACCCCGACGAGGCCGTGGCGTAT
GGTGCGGCGGTGC


BLAST summary (best hit)

trypHTG  BLAST report  
emb|AL499624.2|LMFLCHR36 Leishmania major chromosome 36 clone Chr.36 strain Friedlin, *** SEQUENCING IN PROGRESS ***, in ordered pieces   Goto GenBank  
Score: 539  Expect: 1e-153
sp  BLAST report  
sp|P11145|HS74_TRYBB HEAT SHOCK 70 KD PROTEIN 4 (HSP70)   Goto Swissprot  
Score: 248  Expect: 1e-65
nr  BLAST report  
pir||A44979 heat shock protein 70 - Trypanosoma cruzi (strain Peru) gb|AAA30205.1| (M26595) heat shock protein HSP70 [Trypanosoma cruzi]   Goto GenBank  
Score: 251  Expect: 1e-65
trypEST  BLAST report  
gb|AI069697.1|AI069697 TENU2741 T. cruzi epimastigote normalized cDNA Library Trypanosoma cruzi cDNA clone 26p24 5' similar to T.cruzi mRNA for HSP70 emb|X67716|TCHSPR70, mRNA sequence   Goto GenBank  
Score: 391  Expect: 1e-108

Testcode evaluation

Score  Evaluation  
1.279  coding