genoma.unsam.edu.ar :: tca :: tca-10g6.b1

Sequence

>tca-10g6.b1
CCACGCGTCCGCACGCCGTTCGTGTACCAGAGGCTTTCGTATTTCACCATCGACACGGGG
GTTTTCGGGTGTGCTACAGAGCTTGATAATGAAATGAATTCACTCGGATTCTATGGAGTG
TGCGATGGCGGTATTATACGCGTTGTCGATACATCCCTGCGGTGATGTATGCTAAAAGGA
GAGAGAAAGAAAAAAAAGAAGTGAATGAAGCTGTGGCTTCTATCCATGGATAAATACTTT
TTTAAAAAGAAAAGACAACCTTCATCAACCGATATCATCAATATCACTTTTTGGGTCTT


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
No hits  
nr  BLAST report  
gb|AAF35921.1|AC005892_8 (AC005892) Tubulin-Specific Chaperone [Leishmania major]   Goto GenBank  
Score: 53.9  Expect: 1e-06
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.5663  noncoding