genoma.unsam.edu.ar :: tca :: tca-10m11.b1

Sequence

>tca-10m11.b1
AATTCCCGGGTCGACCCACGCGTCCGGGAAGGATGTGGCGCCTATGTATCTGGAAGGGAT
GGCTTCCTACTTTGGCTGGTTATTCGATGCAAGGTGCCTTTAAATTCGGTCTTTACGAGG
TTTTCAAGGATTTTTATGCGAATATGGCAGGACAAAAGATGGCTAAGGACTATGAGGGTC
TTATTTGGCTTGCAGGTTCTGCCAGCGCTGAATTCTTCGCGGACTTGGCACTGTGCCCAA
TGGAAATGGTCAAGGTGAAGGTACAGACGTCGCCTGTAGGTACGTTTCCCACTGGTTTTT
GTGCGGCTCTATCTACGATGCGAGCTGATCCTAAATCAGGCTTCCCATTTAAGTCACTTG
T


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P40614|MPCP_CAEEL PHOSPHATE CARRIER PROTEIN, MITOCHONDRIAL PRECURSOR (PTP)   Goto Swissprot  
Score: 120  Expect: 4e-27
nr  BLAST report  
gb|AAC47174.1| (U49381) PfMPC [Plasmodium falciparum]   Goto GenBank  
Score: 137  Expect: 2e-31
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.7964  indefinite