genoma.unsam.edu.ar :: tca :: tca-10m8.b1

Sequence

>tca-10m8.b1
CCACGCGTCCGTGGAATTATGATCATTATAGGGAAAACAAAAAGGAGGAAAGAAGAAATT
AATGGCATCCGCTAATGTATTAAAATCTGCTAATAAGGTTGATCTATTTTCCTGGGTCAC
TTGTCCGTTTTGCGTTCGTGCCGAAAAGCTTTTGGCTACCATGACACGAGATATGAAGGT
GTATTATGTGGATAAGATGTCAAATGGCGAAAATTTGCGAAAAGAAATTTTAAGGGATTA
CAATCACGAAACGGTCCCGGCTATA


BLAST summary (best hit)

trypHTG  BLAST report  
No hits  
sp  BLAST report  
sp|P55142|GLRX_ORYSA GLUTAREDOXIN   Goto Swissprot  
Score: 55.5  Expect: 1e-07
nr  BLAST report  
sp|P55142|GLRX_ORYSA GLUTAREDOXIN pir||S41736 glutaredoxin thioltransferase - Rice emb|CAA54397.1| (X77150) glutaredoxin [Oryza sativa]   Goto GenBank  
Score: 55.5  Expect: 7e-07
trypEST  BLAST report  
No hits  

Testcode evaluation

Score  Evaluation  
0.7202  noncoding