genoma.unsam.edu.ar :: tram :: cl434

Sequence

>cl434
AGCTCCCCCGCGGTGGCGGCCGCTTTGTCTCTGCGGCCCTTTTTTTTTTTTTTTTTTGCT
GCGGCTGCTGTTTTCGTTTCTTTTTCTTCTTCTTTCGCCTTTTCACTTATTCATGCCGTA
ATTATATATTTATTTATTAAATATATGAATATATAAATATAGATAATTATTATTAATAGC
AAATGCATATCACTATTTTTATGATCGATTACACTGCCTTCTTCTCCCTTCCCTTCATTT
CCTCCATCCTCATCTTTCCTCCCCATTTCTTCTCTCGACCTCTCGACCTCTTTCTTGCAC
TTCTCTCGTATCATTGATCCACACACACACACACATATGTACACACACATGTGTGTATAA
ATACCGGTAGGATTAAGAAGAGACGCAGTACTCATGTCTGCTTGCATTTCACGAAAAAAA
AAAAGGAAAA

This cluster was built by alignment of 2 ESTs. The members of these cluster are: tctr-389, and tctr-846.


BLAST summary (best hit)

nr  BLAST report  
No hits  
kog  BLAST report  
No hits  
epis  BLAST report  
No hits  
tc_wgs  BLAST report  
No hits  
tc_wgs_lc  BLAST report  
TCIJT50TF M13 For end of clone TCIJT50 (TIGR,616 bases)   Goto TIGR Trypanosoma cruzi Whole Genome Shotgun  
Score: 492  Expect: 1e-137

Testcode evaluation

Score  Evaluation  
0.8033  indefinite  

Trypanosome spliced-leader

Note: the presence of the spliced leader has been assessed using fuzznuc (EMBOSS). We report the presence of the SL sequence in the sequence and the position in the sequence where it is located.

SL  Start  EndMismatches
No ----  ----  ----